GFP 1 GFP Organism: Cryptococcus neoformans serotype A H99S 2022-06-10T23:49:42 Plasmid<a href="https://www.addgene.org/92085/"> YSBE 557 (#92085) </a> Plasmid<a href="https://www.addgene.org/92089/"> YSBE 608 (#92089)</a> Plasmid<a href="https://www.addgene.org/92081/"> YSBE 508 (#92081)</a> This is the coding sequence of the Green Fluorescent Protein (GFP). The atg codon was added at the beginning of the sequence. Present in plasmids: YSBE 508, YSBE 557 e YSBE 608 of the same article. 27780958 GFPSequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactcacggcatggacgagctgtacaagtaa GFP_SBOLDesignerActivity 1 Sophia Garcia de Resende 2022-06-10T20:37:16.641Z Association 1 SBOLDesigner 3.1 SBOLDesigner CAD Tool SBOLDesigner is a simple, biologist-friendly CAD software tool for creating and manipulating the sequences of genetic constructs using the Synthetic Biology Open Language (SBOL) 2 data model. Throughout the design process, SBOL Visual symbols, a system of schematic glyphs, provide standardized visualizations of individual parts. SBOLDesigner completes a workflow for users of genetic design automation tools. It combines a simple user interface with the power of the SBOL standard and serves as a launchpad for more detailed designs involving simulations and experiments. Some new features in SBOLDesigner are the ability to add variant collections to combinatorial derivations, enumerating those collections, and the ability to view sequence features hierarchically. There are also some small changes to the way that preferences work in regards to saving a design with incomplete sequences. Samuel Bridge Chris Myers Michal Galdzicki Michael Zhang John Gennari Sean Sleight Bryan Bartley Evren Sirin