GenBank_AE017348_Region_871991_872263 1 CnU6 Organism: Cryptococcus neoformans var. neoformans JEC21 2022-06-18T14:32:19 GenBank: <a href="https://www.ncbi.nlm.nih.gov/nuccore/AE017348.1">AE017348.1 Region: 871991..872263</a> This is the U6 promoter. That is an endogenous promoter of <i>C. neoformans serotype</i> D strain JEC21. The sequence is available on Reference Article's Supplementary Material and it presented 100% identity with <i>C.neoformans</i> genomic sequence (AE017348). 27503169 GenBank_AE017348_Region_871991_872263Sequence 1 ttgcattagaactaaaaacaaagcatgattattacagttcatttattttttaaattgatcggcatgcatgcaaagtatacgtgcaaggacaatggtaacctgcaggtgtgaccgataattataaccatttgttgagaatgaagaggtgaggagaaaaacaatggatgacgggaaaaaaataaaaaaacactgagacggcgtggaccgccgtcttatttgcttccgttatccgccaaagtggaaattgcacatacaccggcagggtatactgtt GenBank_AE017348_Region_871991_872263_SBOLDesignerActivity 1 Sophia Garcia de Resende 2021-12-10T15:39:07.013Z Association 1 SBOLDesigner 3.1 SBOLDesigner CAD Tool SBOLDesigner is a simple, biologist-friendly CAD software tool for creating and manipulating the sequences of genetic constructs using the Synthetic Biology Open Language (SBOL) 2 data model. Throughout the design process, SBOL Visual symbols, a system of schematic glyphs, provide standardized visualizations of individual parts. SBOLDesigner completes a workflow for users of genetic design automation tools. It combines a simple user interface with the power of the SBOL standard and serves as a launchpad for more detailed designs involving simulations and experiments. Some new features in SBOLDesigner are the ability to add variant collections to combinatorial derivations, enumerating those collections, and the ability to view sequence features hierarchically. There are also some small changes to the way that preferences work in regards to saving a design with incomplete sequences. Samuel Bridge Chris Myers Michal Galdzicki Michael Zhang John Gennari Sean Sleight Bryan Bartley Evren Sirin