GenBank_AE017353_Region_190704_1911746 1 GAL7 Organism: Cryptococcus neoformans var. neoformans JEC21 2022-06-18T14:49:47 GenBank: <a href="https://www.ncbi.nlm.nih.gov/nucleotide/AE017353.1?report=genbank&log$=nuclalign&blast_rank=2&RID=V59YNAW5013&from=190704&to=191174">AE017353 Region: 190704..191174</a> This is the galactose-1-fosfato uridililtransferase promoter. The GAL7 promoter is induced by galactose and repressed by glucose. The 3' primer used to amplify the GAL7 promoter region encopassed part of the first exon, therefore this part was excluded from the promoter presented here, diminishing the size of this promoter from 582 to 471 bp. Some SNPs were also detected in relation to the sequence presented in the original article, therefore the genomic sequence (AE017353) was used here. 8577246 GenBank_AE017353_Region_190704_1911746Sequence 1 agaagcaggtcttgtcgaaccccggggatgcgacagcagaggttcgaacacgcaaaatcgtaatttgatatttatatgcgcgcccaccttcgctgacaattcccgttcatgaatcgtttgtcagtaattgacgcgccgggggtgccttgggggagtgttgtcaattaacatacaaatattcccgttcgtatcaatttgcatatccatctcatcacatagtagtattcccgttcgtatccatttgcatatctcgtcacatagtcttcccgttcgtatccatttcatatcgtaacatcatacagtcttcacaatcttcccgttcgtcctctcatcgtcaagccattgattgtcaatacacgcctacatattcccgttctcttgtctgccacatcgctcgtgcgttcttcccgtttttatgggaagactggggtcatgtcgtcaatacagcagcagacataatgggtgttatat GenBank_AE017353_Region_190704_1911746_SBOLDesignerActivity 1 Sophia Garcia de Resende 2021-12-10T02:57:19.191Z Association 1 SBOLDesigner 3.1 SBOLDesigner CAD Tool SBOLDesigner is a simple, biologist-friendly CAD software tool for creating and manipulating the sequences of genetic constructs using the Synthetic Biology Open Language (SBOL) 2 data model. Throughout the design process, SBOL Visual symbols, a system of schematic glyphs, provide standardized visualizations of individual parts. SBOLDesigner completes a workflow for users of genetic design automation tools. It combines a simple user interface with the power of the SBOL standard and serves as a launchpad for more detailed designs involving simulations and experiments. Some new features in SBOLDesigner are the ability to add variant collections to combinatorial derivations, enumerating those collections, and the ability to view sequence features hierarchically. There are also some small changes to the way that preferences work in regards to saving a design with incomplete sequences. Samuel Bridge Chris Myers Michal Galdzicki Michael Zhang John Gennari Sean Sleight Bryan Bartley Evren Sirin