GenBank_CP003830_Region_176667_176966 1 HOG1 Organism: Cryptococcus neoformans var. grubi H99 2022-06-20T00:54:38 GenBank: <a href="https://www.ncbi.nlm.nih.gov/nucleotide/CP003830.1?report=genbank&log$=nuclalign&blast_rank=4&RID=VC1BR1SW016&from=176667&to=176966">CP003830 Region: 176667..176966</a> Plasmid: <a href="https://www.addgene.org/92081/">YSBE 508 (#92081)</a> This is the terminator of mitogen-activated protein kinase (HOG1). This terminator is delimited by primers present in the reference article. There is a SNP in relation to the genomic sequence (CP003830). We used the genomic sequence. 27780958 GenBank_CP003830_Region_176667_176966Sequence 1 aagaatcgttcttctttctttctttctttttatttataacgaaagaagagatgttggcgtatacttgaacttatgaatgatgtgttgtattcaggagcctgaaagtaatgtggtgtgtggtgggcggtgggacgaggaagagtcgggataagttgggatgatagatggtggagcaagattgcataagcaaaagttgagaagcgcaaagttgagaagaagtgtggacggctcgtgttgcgggttcagggagcagaagggagggaatgtggagattgttcggagagagggatagattgggac GenBank_CP003830_Region_176667_176966_SBOLDesignerActivity 1 Sophia Garcia de Resende 2021-12-12T14:57:22.568Z Association 1 SBOLDesigner 3.1 SBOLDesigner CAD Tool SBOLDesigner is a simple, biologist-friendly CAD software tool for creating and manipulating the sequences of genetic constructs using the Synthetic Biology Open Language (SBOL) 2 data model. Throughout the design process, SBOL Visual symbols, a system of schematic glyphs, provide standardized visualizations of individual parts. SBOLDesigner completes a workflow for users of genetic design automation tools. It combines a simple user interface with the power of the SBOL standard and serves as a launchpad for more detailed designs involving simulations and experiments. Some new features in SBOLDesigner are the ability to add variant collections to combinatorial derivations, enumerating those collections, and the ability to view sequence features hierarchically. There are also some small changes to the way that preferences work in regards to saving a design with incomplete sequences. Samuel Bridge Chris Myers Michal Galdzicki Michael Zhang John Gennari Sean Sleight Bryan Bartley Evren Sirin