BBa_B0013 1 BBa_B0013 TE from coliphage T7 (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Strong transcriptional terminator consisting of a 20 bp stem-loop that has been engineered to be bidirectional. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG). Subsequently mutations were introduced to make the terminator bi-directional (i.e., AAAAAA insertion on 5' side of the stem loop). Additional mutations were introduced on the 3' side of the stem loop to increase the number of T's and eliminate any promoter -10 site that might be present to avoid initiation of transcription of whatever is downstream.<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1695 1 C range1695 1 37 37 annotation1697 1 '' range1697 1 1 6 annotation1691 1 T7 TE range1691 1 14 33 annotation7021 1 BBa_B0013 range7021 1 1 47 annotation1696 1 C range1696 1 10 10 annotation1692 1 stop range1692 1 40 40 annotation1698 1 polya range1698 1 34 47 BBa_B0013_sequence 1 aaaaaatcaaactggctcaccttcgggtgggcctttttgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z