BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0017 1 BBa_B0017 double terminator (B0010-B0010) 2004-01-08T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator with two copies of <bb_part>BBa_B0010</bb_part> false false _1_ 0 24 7 In stock false true Austin Che component939331 1 BBa_B0010 component939337 1 BBa_B0010 annotation939331 1 BBa_B0010 range939331 1 1 80 annotation939337 1 BBa_B0010 range939337 1 89 168 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0017_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z