BBa_B0020 1 BBa_B0020 Terminator (Reverse B0010) 2003-10-07T11:00:00Z 2015-08-31T04:07:20Z Antiquity. thought to be T1 transcriptional terminator from E. coli RRNB operon. Transcriptional terminator consisting of a 64 bp stem-loop (B0010), cloned onto the antisense strand. false false _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation354342 1 stem_loop range354342 1 27 70 BBa_B0020_sequence 1 ggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z