BBa_B0052 1 BBa_B0052 Terminator (rrnC) 2004-01-29T12:00:00Z 2015-08-31T04:07:20Z Terminator from the E.coli ribosonal RNA rrnC operon. This terminator occurs in the reverse orientation upstream of the multiple cloning site of the pSB**1-pSB**3 series of plasmids. false false _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318601 1 stem_loop range318601 1 9 28 BBa_B0052_sequence 1 agaaatcatccttagcgaaagctaaggattttttttatctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z