BBa_B0100 1 OmpA 5 OmpA 5 2007-02-28T12:00:00Z 2015-08-31T04:07:21Z MG1655 genome, OmpA gene 5 prime UTR from the OmpA gene in E.coli used for stabilizing the downstream RNA transcript false false _11_ 0 571 10 Not in stock false This region was PCR amplified from the genome of MG1655. false Heather Keller annotation1919684 1 ss2 range1919684 1 104 115 annotation1919681 1 hp1 range1919681 1 1 63 annotation1919683 1 hp2 range1919683 1 75 103 annotation1919682 1 ss1 range1919682 1 64 74 BBa_B0100_sequence 1 gccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z