BBa_B0101 1 HP3 3 HP3 3 2007-02-28T12:00:00Z 2015-08-31T04:07:21Z The part was made by primer annealing. 3' stabilizing mRNA designed by Christina Smolke and Jay Keasling for stabilizing gfp. false false _11_ 0 571 10 Not in stock false A single base pair change (A to T at position 25) from the original design was made in order to remove a PstI site occurring in the loop of the hairpin. This should have no effect on the secondary structure. false Heather Keller annotation1919685 1 stem_loop range1919685 1 6 58 BBa_B0101_sequence 1 gatcgcctgatcccggtgcacccgggcagctgcatagtctgggtgcaccgggatcagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z