BBa_B2002 1 T7 0.4 T7 RBS 0.4 2006-09-27T11:00:00Z 2015-08-31T04:07:21Z Genome of wild-type bacteriophage T7, positions 2001-2020. Includes the -20 to -1 region of gp0.7. This is the -20 to -1 region of T7 gp0.7, which contains the native RBS region for this gene. The physical instantiation of this part does not exist. This part is not compatible with Standard Biobricks assembly methods, as the scar created during assembly would interrupt the spacing between the RBS and the start codon of the CDS. Individuals wishing to use this RBS sequence in their assembles should refer to part XXXXX. (Information forthcoming) false true _11_ 0 571 10 Not in stock false The -20 to -1 region was chosen to be representative of the RBS region of the T7 genes for the following reasons: 1) The Shine-Delgarno region is contained within this defined region for all T7 genes. 2) Current literature suggests that when bound to the Translation Start Site (0), the Ribosome covers positions -20 to +13. false Heather Keller annotation1902419 1 SD region range1902419 1 4 10 BBa_B2002_sequence 1 tacgaggaggatgaagagta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z