BBa_C0053 1 c2 P22 c2 repressor from Salmonella phage P22 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage P22 Released HQ 2013 The P22 c2 repressor protein coding sequence is a 720 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the P22 c2 regulatory sequence, BBa_R0053. The sequence contains a LVA tag for faster degredation.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P> References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P><P> true Maia Mahoney annotation7036 1 BBa_C0053 range7036 1 1 687 annotation1750 1 LVA range1750 1 649 681 annotation2213993 1 Help:Barcodes range2213993 1 688 712 annotation1747 1 cII p22 range1747 1 1 648 annotation1751 1 stop range1751 1 682 687 BBa_C0053_sequence 1 atgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z