BBa_C0072 1 mnt (s) mnt repressor (strong) from Salmonella phage P22 (+LVA) 2004-01-28T12:00:00Z 2015-08-31T04:07:23Z enterobacteriophage p22 Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false wild type dimeric repressor from enterobacteriophage p22 with dissociation constant of 2.5*10^-12.<br/><br/> sequence was translated with the E.Coli K12 codon usage table, and nucleotides 95-97 was changed from AAT to AAC to avoid the cut site GAATTC (94-99).<br/><br/> Identification of Functionally Important Residues in the DNA Binding Region of the MNT Repressor <br/> Kendall, KL; Sauer, RT <br/> The Journal of Biological Chemistry, 264(23):13706-13710, 1989 true crackdots annotation2214010 1 Help:Barcodes range2214010 1 289 313 annotation308502 1 T range308502 1 95 97 annotation308499 1 mnt range308499 1 1 249 annotation308503 1 LVA range308503 1 250 282 BBa_C0072_sequence 1 atggcccgggatgatcctcacttcaattttcgtatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z