BBa_C0073 1 mnt (w) mnt repressor (weak) from Salmonella phage P22 (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:23Z enterobacteriophage p22 Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false dimeric repressor from enterobacteriophage p22 with dissociation constant of 3*10^-8.<br/><br/> sequence was translated with the E.Coli K12 codon usage table, and nucleotides 95-97 was changed from AAT to AAC to avoid the cut site GAATTC (94-99).<br/><br/> the mutation R10->K10 (ctg->aaa) decreases the binding affinity of the mnt protein to its operator by approximately 12,000 fold (Kd: 2.5e-12 to 3e-8) true crackdots annotation2214006 1 Help:Barcodes range2214006 1 289 313 annotation306535 1 LVA range306535 1 250 282 annotation308457 1 T range308457 1 95 97 annotation302631 1 mnt range302631 1 1 249 annotation308213 1 Arg->Lys (ctg) range308213 1 31 33 BBa_C0073_sequence 1 atggcccgggatgatcctcacttcaattttaaaatgccaatggaagtaagagagaaattgaaatttagagcagaggcaaacggacggagcatgaactctgagcttttgcaaatcgtacaagatgccctaagcaaaccgtcaccagtcactgggtaccgcaatgatgcggaacgactcgccgatgagcagagcgagttagtgaagaagatggtcttcgatacactgaaggatctttataaaaaaaccaccgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z