BBa_C0074 1 penI penI repressor from Bacillus licheniformis (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:23Z bacillus licheniformis Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false Since penI is being ported from Bacillus Licheniformis, the sequence was changed within the coding region to reflect codon usage in E.Coli K12. Codons were mapped to the codon of the same usage rank in E.Coli. true crackdots annotation306563 1 LVA range306563 1 385 417 annotation2214009 1 Help:Barcodes range2214009 1 424 448 annotation302638 1 penI range302638 1 1 387 BBa_C0074_sequence 1 atgaaaaaaataccacagatttctgatgcggaactcgaagtcatgaaagtgatttggaagcattcttccattaatactaatgaggtaatcaaagagctcagtaaaacttcaacgtggagcccaaaaactattcagactatgctgctgcgccttatcaaaaaaggcgctctcaaccaccataaagaaggtcgggttttcgtttacacgcctaatatagacgaatcagattatatagaggttaagtcacactcatttctcaaccggttttacaatggtacattaaattccatggtactcaactttttggagaatgatcaactgtcgggagaagaaatcaatgaattgtatcagatactcgaagaacataagaaccgtaagaaggaagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z