BBa_C2000 1 zif23 Repressor, Zif23-GCN4 (RBS-, LVA+) 2004-01-25T12:00:00Z 2015-08-31T04:07:25Z Zif268 and GCN4 [Wolfe00] Coding region for Zif23-GCN4. This protein is constructed out of fingers 2 and 3 from Zif268 fused with the leucine zipper domain from GCN4. The protein binds cooperatively as a dimer to a symmetric target DNA sequence in which each monomer targets 5'-GCGTGG-3'. false false _1_ 0 24 7 Not in stock false As in [Wolfe00], the protein uses residues 364-412 of Zif268: <a href="http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=BAC30748.1">BAC30748.1</a> <br> The corresponding nucleotide sequence was taken from: <a href="http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AK040925.1">AK040925.1</a> <br> <P>As in [Wolfe00], the protein uses residues 250-281 of GCN4: <a href="http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AAA34640.1">AAA34640.1</a> <br> The corresponding nucleotide sequence was taken from: <a href="http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=171581">K02205.1</a> <br> false Ronny Krashinsky annotation2213994 1 Help:Barcodes range2213994 1 268 292 annotation297319 1 Zif268: Finger 2 range297319 1 7 90 annotation297320 1 Zif268: Finger 3 (partial) range297320 1 91 150 annotation297322 1 GCN4: leucine zipper range297322 1 166 261 annotation297321 1 linker range297321 1 151 165 annotation297323 1 Finger2 Recognition range297323 1 43 63 annotation297324 1 Finger 3 Recognition range297324 1 127 147 BBa_C2000_sequence 1 atgaagcccttccagtgtcgaatctgcatgcgtaacttcagtcgtagtgaccaccttaccacccacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtgggaggaagtttgccaggagtgatgaacgcaagaggcatagaaagttgcaacatatgaaacaacttgaagacaaggttgaagaattgctttcgaaaaattatcacttggaaaatgaggttgccagattaaagaaattagttggcgaacgctaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z