BBa_C2001 1 zif23 Zif23-GCN4 engineered repressor (+LVA, C2000 codon-optimized for E.coli) 2004-01-29T12:00:00Z 2015-08-31T04:07:25Z Protein Engineering Gods from the Pabo Lab Released HQ 2013 Variant of Zif23-GCN4 (see BBa_C2000). CDS has been optimized (via VNTI) for expression in enteric bacteria. ssrA tag (LVA) added. false false _1_ 0 24 7 In stock false This protein should form a dimer and bind a specific operator site, thus repressing transcription. false Drew Endy annotation2214011 1 Help:Barcodes range2214011 1 301 325 annotation318104 1 linker range318104 1 151 165 annotation318106 1 LVA range318106 1 262 294 annotation318109 1 Recognition site range318109 1 127 147 annotation318107 1 2 range318107 1 295 300 annotation318101 1 Finger 2 range318101 1 4 90 annotation318103 1 Finger 3 range318103 1 91 150 annotation318105 1 GCN4: leucine zipper range318105 1 166 261 annotation318108 1 Recognition site range318108 1 43 63 BBa_C2001_sequence 1 atgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgtgctgctaacgacgaaaactacgctctggttgcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z