BBa_C2002 1 BBa_C2002 Homodimeric zinc finger 2006-05-31T11:00:00Z 2015-08-31T04:07:25Z false false _41_ 0 126 84 Not in stock false false Reshma Shetty annotation1878172 1 DNA recognition site range1878172 1 127 147 annotation1878176 1 double stop codon range1878176 1 280 285 annotation1878169 1 Zif268 finger 2 range1878169 1 4 90 annotation1878173 1 domain linker range1878173 1 151 165 annotation1878175 1 hexaHis tag range1878175 1 262 279 annotation1878170 1 DNA recognition site range1878170 1 43 63 annotation1878174 1 GCN4 homodimerization domain range1878174 1 166 261 annotation1878171 1 Zif268 finger 3 range1878171 1 91 150 annotation1878168 1 start codon range1878168 1 1 3 BBa_C2002_sequence 1 atgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgtcatcaccatcaccatcactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z