BBa_C2004 1 BBa_C2004 Homodimeric zinc finger 2006-10-20T11:00:00Z 2015-08-31T04:07:25Z It was derived from BBa_C2002. This is protein based on Scot Wolfe's Zif268-GCN4 homodimeric zinc finger protein. It is a fusion of fingers 2 and 3 of Zif268 (mouse) and the leucine zipper domain of GCN4 (yeast). Scot optimized the linker between the zinc finger domain and the leucine zipper domain to increase affinity of the homodimer for the 12bp operator. It is codon optimized for E. coli. false false _41_ 0 126 70 Not in stock false It is codon optimized for E. coli. false Reshma Shetty annotation1903896 1 hexaHis tag range1903896 1 265 282 annotation1903898 1 domain linker range1903898 1 151 177 annotation1903900 1 double stop codon range1903900 1 283 288 annotation1903894 1 start codon range1903894 1 1 3 annotation1903895 1 Zif268.GCN4(-2) codon optimized range1903895 1 1 288 annotation1903899 1 GCN4 homodimerization domain range1903899 1 178 264 annotation1903897 1 Finger 3 of Zif268 range1903897 1 91 150 annotation1903893 1 Finger 2 of Zif268 range1903893 1 4 90 BBa_C2004_sequence 1 atgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtgatattcagcatattctgccgattctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgtcatcaccatcaccatcactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z