BBa_C2005 1 BBa_C2005 Homodimeric zinc finger 2006-10-20T11:00:00Z 2015-08-31T04:07:25Z This part is derived from BBa_C2002. This is protein based on Scot Wolfe's Zif268-GCN4 homodimeric zinc finger protein. It is a fusion of fingers 2 and 3 of Zif268 (mouse) and the leucine zipper domain of GCN4 (yeast). false false _41_ 0 126 70 Not in stock false This protein contains no tags (like an LVA tag or His tag). false Reshma Shetty annotation1903901 1 Zif268.GCN4 range1903901 1 1 267 annotation1903907 1 double stop codon range1903907 1 262 267 annotation1903906 1 GCN4 leucine zipper homodimerization domain range1903906 1 166 261 annotation1903902 1 finger 2 of Zif268 range1903902 1 4 90 annotation1903904 1 start codon range1903904 1 1 3 annotation1903905 1 domain linker range1903905 1 151 165 annotation1903903 1 finger 3 of Zif268 range1903903 1 91 150 BBa_C2005_sequence 1 atgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z