BBa_C2030 1 BBa_C2030 Fos 2008-05-04T11:00:00Z 2015-08-31T04:07:25Z Original template provided by Amy Keating. Encodes the Fos leucine zipper domain false false _41_ 0 126 162 Not in stock false There is an A->T mutation in the BioBrick prefix site (between the NotI and XbaI sites) so that the appropriate amino acid linker is produced when cloning in-frame with a zinc finger domain. false Reshma Shetty annotation1962329 1 Leucine zipper (uniprot) range1962329 1 13 99 annotation1962328 1 Fos dimerization domain range1962328 1 1 129 annotation1962330 1 Double TAA stop codon range1962330 1 124 129 BBa_C2030_sequence 1 cacactgatacactccaagcggagacagaccaactagaagatgagaagtctgctttgcagaccgagattgccaacctgctgaaggagaaggaaaaactagagttcatcctggcagctcaccgataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z