BBa_C2033 1 BBa_C2033 p53ZF Fingers 1 and 2 2008-05-04T11:00:00Z 2015-08-31T04:07:25Z Original template provided by Scott Wolfe. Encodes zinc finger domain p53ZF fingers 1 and 2 false false _41_ 0 126 162 Not in stock false This part has a modified BioBrick suffix in which the single T prior to the SpeI site has been deleted to facilitate in frame protein fusions during BioBrick assembly. false Reshma Shetty annotation1962341 1 Zinc finger 1 range1962341 1 7 96 annotation1962344 1 Helix 2 range1962344 1 133 156 annotation1962345 1 DNA binding domain range1962345 1 1 156 annotation1962343 1 Helix 1 range1962343 1 52 87 annotation1962342 1 Zinc finger 2 range1962342 1 97 156 BBa_C2033_sequence 1 atgaagccgtacgcatgtccagtagaaagctgtgaccgtcgcttctcaacgaagcagcaccttaaggagcacatccgtattcacaccgggcaaaaaccgtttcaatgccgcatttgtatgcggaatttctcacagcgcggcacccttacccgccatcgcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z