BBa_C2045 1 BBa_C2045 Zif268 fingers 2 and 3.JunD 2008-05-05T11:00:00Z 2015-08-31T04:07:25Z Composite part of BBa_C2034 and BBa_C2032 using non-standard BioBrick assembly (similar but not identical to the Silver lab fusion technique). Encodes a zinc finger-leucine zipper fusion. The zinc finger domain is fingers 2 and 3 of Zif268 and the leucine zipper domain is JunD. false false _41_ 0 126 162 Not in stock false In frame assembly. false Reshma Shetty annotation1962428 1 Dimerization domain range1962428 1 157 291 annotation1962424 1 Finger 2 range1962424 1 7 90 annotation1962426 1 Start codon range1962426 1 1 3 annotation1962429 1 Synthetic transcription factor range1962429 1 1 291 annotation1962425 1 Leucine zipper (uniprot) range1962425 1 175 261 annotation1962427 1 Double TAA stop codon range1962427 1 286 291 BBa_C2045_sequence 1 atgaagcccttccagtgtcgaatctgcatgcgtaacttcagtcgtagtgaccaccttaccacccacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtgggaggaagtttgccaggagtgatgaacgcaagaggcatcgcaaactagagcacatctcgcgcctggaagagaaagtgaagaccctcaagagtcagaacacggagctggcgtccacggcgagcctgctgcgcgagcaggtggcgcagctcaagcagaaagtcctcagccacgtctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z