BBa_E0029 1 BBa_E0029 lacZalpha fragment 2007-08-15T11:00:00Z 2015-08-31T04:07:25Z It comes from Escherichia coli's lacZ gene. This is the N-terminal alpha fragment of lacZ. It can be used for alpha-complementation. false true _41_ 0 126 162 Not in stock false I added a double TAATAA stop codon. The boundaries of the alpha fragment were determined according to Benno Muller-Hill's book called "The lac operon". false Reshma Shetty annotation1941583 1 lacZalpha fragment range1941583 1 1 186 BBa_E0029_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z