BBa_E0035 1 BBa_E0035 LacZ alpha fragment; complements matching N-terminal deletion mutant (lacZ-omega) 2007-12-21T12:00:00Z 2015-08-31T04:07:25Z This part is derived from BBa_E0033. This part encodes the alpha fragment of the lacZ gene. To greatly reduce the number of bases, this is only a portion of the LacZ gene. It can be used as a detection system with N-terminal deletion mutants of lacZ. Combination of lacZ-alpha with such a deletion mutant protein restores enzyme activity that can be assayed colorimetrically or more sensitively with chemiluminescent substrates. false false _41_ 0 126 162 Not in stock false It has the additional T needed to ensure that the double stop codon is in frame. false Reshma Shetty annotation1959037 1 T3 promoter range1959037 1 26 35 annotation1959042 1 C range1959042 1 108 108 annotation1959039 1 C range1959039 1 78 78 annotation1959040 1 T range1959040 1 81 81 annotation1959045 1 inserted T range1959045 1 348 348 annotation1959035 1 lacZ gene fragment range1959035 1 1 15 annotation1959038 1 T7 promoter range1959038 1 173 191 annotation1959036 1 lacZ alpha range1959036 1 1 354 annotation1959041 1 A range1959041 1 87 87 annotation1959046 1 barcode range1959046 1 355 379 annotation1959043 1 G range1959043 1 111 111 annotation1959044 1 lacZ gene fragment range1959044 1 199 348 BBa_E0035_sequence 1 atgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaattaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z