BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_E5502 1 BBa_E5502 M0100.B0015 2005-05-16T11:00:00Z 2015-08-31T04:07:27Z Released HQ 2013 M0100.B0015 false false _1_ 0 61 1 In stock false false jcbraff component1489105 1 BBa_M0100 component1489110 1 BBa_B0010 component1489120 1 BBa_B0012 annotation1489110 1 BBa_B0010 range1489110 1 94 173 annotation1489120 1 BBa_B0012 range1489120 1 182 222 annotation1489105 1 BBa_M0100 range1489105 1 1 85 BBa_M0100 1 BBa_M0100 tRNA_Arg5 to use as transcriptional reporter 2005-03-25T12:00:00Z 2015-05-08T01:13:51Z Released HQ 2013 tRNA_Arg5 to use as transcriptional reporter. Sequence is natural tRNA_Arg5 except with A to U mutation near its 3' end. false false _11_1_ 0 61 7 In stock false true jcbraff BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_E5502_sequence 1 gatctgcattgtcctcttagttaaatggatataacgagcccctcctaagggctaattgcaggttcgattcctgcaggggactccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_M0100_sequence 1 gatctgcattgtcctcttagttaaatggatataacgagcccctcctaagggctaattgcaggttcgattcctgcaggggactcca BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z