BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_C0076 1 cinI autoinducer synthetase 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z Rhizobium leguminosarum Released HQ 2013 cinI codes for an autoinducer synthetase which utilizes SAM to make O3-C14:1-HSL. In complex with O3-C14:1-HSL, CinR (BBa_C0077) binds to the Cin promoter (BBa_R0077) and activates transcription. false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 <P>Change log: original STOP: tga -> tAaTAA true crackdots annotation2214001 1 Help:Barcodes range2214001 1 703 727 annotation306586 1 LVA range306586 1 664 696 annotation301035 1 CinI range301035 1 1 663 BBa_F1760 1 BBa_F1760 3OC₁₄HSL Sender Device 2004-07-12T11:00:00Z 2015-08-31T04:07:27Z Sender device which accepts PoPS input and produces an enzyme CinI. This enzyme produces the 3OC₁₄HSL signaling molecule. false false _6_ 0 101 7 It's complicated false false mit component943362 1 BBa_B0012 component943346 1 BBa_C0076 component943336 1 BBa_B0034 component943352 1 BBa_B0010 annotation943336 1 BBa_B0034 range943336 1 1 12 annotation943362 1 BBa_B0012 range943362 1 842 882 annotation943352 1 BBa_B0010 range943352 1 754 833 annotation943346 1 BBa_C0076 range943346 1 19 720 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_C0076_sequence 1 atgttcgttatcatccaggctcacgaataccagaaatacgctgctgttctggaccagatgttccgtctgcgtaaaaaagttttcgctgacaccctgtgctgggacgttccggttatcggtccgtacgaacgtgactcctacgactccctggctccggcttacctggtttggtgcaacgactcccgtacccgtctgtacggtggtatgcgtctgatgccgaccaccggtccgaccctgctgtacgacgttttccgtgaaaccttcccggacgctgctgacctgatcgctccgggtatctgggaaggtacccgtatgtgcatcgacgaagaagctatcgctaaagacttcccggaaatcgacgctggtcgtgctttctccatgatgctgctggctctgtgcgaatgcgctctggaccacggtatccacaccatgatctccaactacgaaccgtacctgaaacgtgtttacaaacgtgctggtgctgaagttgaagaactgggtcgtgctgacggttacggtaaatacccggtttgctgcggtgctttcgaagtttccgaccgtgttctgcgtaaaatgcgtgctgctctgggtctgaccctgccgctgtacgttcgtcacgttccggctcgttccgttgttacccagttcctggaaatggctgctgctgctaacgacgaaaactacgctctggttgcttaataaccctgatagtgctagtgtagatccc BBa_F1760_sequence 1 aaagaggagaaatactagatgttcgttatcatccaggctcacgaataccagaaatacgctgctgttctggaccagatgttccgtctgcgtaaaaaagttttcgctgacaccctgtgctgggacgttccggttatcggtccgtacgaacgtgactcctacgactccctggctccggcttacctggtttggtgcaacgactcccgtacccgtctgtacggtggtatgcgtctgatgccgaccaccggtccgaccctgctgtacgacgttttccgtgaaaccttcccggacgctgctgacctgatcgctccgggtatctgggaaggtacccgtatgtgcatcgacgaagaagctatcgctaaagacttcccggaaatcgacgctggtcgtgctttctccatgatgctgctggctctgtgcgaatgcgctctggaccacggtatccacaccatgatctccaactacgaaccgtacctgaaacgtgtttacaaacgtgctggtgctgaagttgaagaactgggtcgtgctgacggttacggtaaatacccggtttgctgcggtgctttcgaagtttccgaccgtgttctgcgtaaaatgcgtgctgctctgggtctgaccctgccgctgtacgttcgtcacgttccggctcgttccgttgttacccagttcctggaaatggctgctgctgctaacgacgaaaactacgctctggttgcttaataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z