BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0078 1 lasI autoinducer synthetase for PAI from Pseudomonas aeruginosa 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z www.ncbi.nlm.nih.gov Released HQ 2013 coding region for lasI protein, which produces the chemical signal AI-1 false false _1_ 0 24 7 In stock false true Chris Walsh (Fighting Darwins) annotation306608 1 LVA range306608 1 604 636 annotation305970 1 LasI range305970 1 1 603 annotation2214003 1 Help:Barcodes range2214003 1 643 667 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_F1780 1 BBa_F1780 AI-1 Sender Device 2004-07-12T11:00:00Z 2015-08-31T04:07:27Z Sender device which accepts PoPS input and produces an enzyme LasI. This enzyme produces the AI-1 signaling molecule false false _6_ 0 101 7 In stock false false Fred, Jay, Madeline, Debra component943205 1 BBa_B0034 component943221 1 BBa_B0010 component943215 1 BBa_C0078 component943231 1 BBa_B0012 annotation943205 1 BBa_B0034 range943205 1 1 12 annotation943221 1 BBa_B0010 range943221 1 694 773 annotation943231 1 BBa_B0012 range943231 1 782 822 annotation943215 1 BBa_C0078 range943215 1 19 660 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0078_sequence 1 atgatcgttcagatcggtcgtcgtgaagagttcgacaaaaaactgctgggtgaaatgcacaaactgcgtgctcaggttttcaaagaacgtaaaggttgggacgtttccgttatcgacgaaatggaaatcgacggttacgacgctctgtccccgtactacatgctgatccaggaagacaccccggaagctcaggttttcggttgctggcgtatcttcgacaccaccggtccgtacatgctgaaaaacaccttcccggaactgctgcacggtaaagaagctccgtgctccccgcacatctgggaactgtcccgtttcgctatcaactccggtcagaaaggttccctgggtttctccgactgcaccctggaagctatgcgtgctctggctcgttactccttgcagaacgacatccagaccctggttaccgttaccaccgttggtgttgaaaaaatgatgatccgtgctggtctggacgtttcccgtttcggtccgcacctgaaaatcggtatcgaacgtgctgttgctctgcgtatcgaactgaacgctaaaacccagatcgctctgtacggtggtgttctggttgaacagcgtctggctgtttccgctgctaacgacgaaaactacgctctggttgcttaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_F1780_sequence 1 aaagaggagaaatactagatgatcgttcagatcggtcgtcgtgaagagttcgacaaaaaactgctgggtgaaatgcacaaactgcgtgctcaggttttcaaagaacgtaaaggttgggacgtttccgttatcgacgaaatggaaatcgacggttacgacgctctgtccccgtactacatgctgatccaggaagacaccccggaagctcaggttttcggttgctggcgtatcttcgacaccaccggtccgtacatgctgaaaaacaccttcccggaactgctgcacggtaaagaagctccgtgctccccgcacatctgggaactgtcccgtttcgctatcaactccggtcagaaaggttccctgggtttctccgactgcaccctggaagctatgcgtgctctggctcgttactccttgcagaacgacatccagaccctggttaccgttaccaccgttggtgttgaaaaaatgatgatccgtgctggtctggacgtttcccgtttcggtccgcacctgaaaatcggtatcgaacgtgctgttgctctgcgtatcgaactgaacgctaaaacccagatcgctctgtacggtggtgttctggttgaacagcgtctggctgtttccgctgctaacgacgaaaactacgctctggttgcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z