BBa_F2770 1 BBa_F2770 3OC₁₄HSL Receiver Device 2005-06-23T11:00:00Z 2015-08-31T04:07:27Z This device senses the 3OC14HSL concentration in the media and produces output PoPS. CinR production is controlled by the tet repressible R0040. false false _11_ 0 371 11 Not in stock false false labnoa component1537997 1 BBa_R0077 component1537980 1 BBa_B0012 component1537955 1 BBa_R0040 component1537970 1 BBa_B0010 component1537963 1 BBa_B0034 component1537965 1 BBa_C0177 annotation1537980 1 BBa_B0012 range1537980 1 906 946 annotation1537970 1 BBa_B0010 range1537970 1 818 897 annotation1537965 1 BBa_C0177 range1537965 1 81 809 annotation1537963 1 BBa_B0034 range1537963 1 63 74 annotation1537955 1 BBa_R0040 range1537955 1 1 54 annotation1537997 1 BBa_R0077 range1537997 1 955 1185 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0077 1 cinR Promoter (cinR and HSL regulated, RBS+) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z Rhizobium leguminosarum Released HQ 2013 CinR (BBa_C0077) in complex with O3-C14:1-HSL (from CinI, BBa_C0076) binds to this promoter and activates transcription. This promoter contains the RBS: TGGAGG false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 Change log: the last 5 bases (gctaa) removed to allow for the correct spacing between the RBS (TGGAGG) and the start of the downstream gene after biobricks splicing. true crackdots annotation301205 1 stem_loop range301205 1 91 136 annotation301204 1 stem_loop range301204 1 35 74 annotation301150 1 embedded RBS range301150 1 226 231 annotation301371 1 unidentified/uncharacterized CinR dependent range301371 1 1 220 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0177 1 cinR cinR (-LVA) 2004-05-26T11:00:00Z 2015-08-31T04:07:24Z same as C0077 except no LVA tag false false _11_1_ 0 61 7 Not in stock false false jcbraff BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0077_sequence 1 ccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgctggagg BBa_F2770_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgattgagaatacctatagcgaaaagttcgagtccgcgttcgaacagatcaaggcggcggccaacgtggatgccgccatccgtattctccaggcggaatataacctcgatttcgtcacctaccatctcgcccagacgatcgcgagcaagatcgattcgcccttcgtgcgcaccacctatccggatgcctgggtttcccgctacctcctcaacagctatgtgaaggtcgatccgatcgtcaagcagggcttcgaacgccagctgcccttcgactggagcgaggtcgaaccgacgccggaggcctatgccatgctggtcgacgcccagaaacacggcatcggtggcaatggctactccatccccgtcgccgacaaggcgcagcgccgcgccctgctgtcgctgaatgcccgtataccggccgacgaatggaccgagctcgtgcgccgctgccgcaacgagtggatcgagatcgcccatctgatccaccgcaaggccgtctatgagctgcatggcgaaaacgatccggtgccggcattgtcgccgcgcgagatcgagtgtctgcactggaccgccctcggcaaggattacaaggatatttcggtcatcctgggcatatcagagcataccacacgcgattacctgaagaccgcccgcttcaagctcggctgcgccacgatctcggccgccgcgtcgcgggctgttcaattgcgcatcatcaatccctaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgctggagg BBa_B0034_sequence 1 aaagaggagaaa BBa_C0177_sequence 1 atgattgagaatacctatagcgaaaagttcgagtccgcgttcgaacagatcaaggcggcggccaacgtggatgccgccatccgtattctccaggcggaatataacctcgatttcgtcacctaccatctcgcccagacgatcgcgagcaagatcgattcgcccttcgtgcgcaccacctatccggatgcctgggtttcccgctacctcctcaacagctatgtgaaggtcgatccgatcgtcaagcagggcttcgaacgccagctgcccttcgactggagcgaggtcgaaccgacgccggaggcctatgccatgctggtcgacgcccagaaacacggcatcggtggcaatggctactccatccccgtcgccgacaaggcgcagcgccgcgccctgctgtcgctgaatgcccgtataccggccgacgaatggaccgagctcgtgcgccgctgccgcaacgagtggatcgagatcgcccatctgatccaccgcaaggccgtctatgagctgcatggcgaaaacgatccggtgccggcattgtcgccgcgcgagatcgagtgtctgcactggaccgccctcggcaaggattacaaggatatttcggtcatcctgggcatatcagagcataccacacgcgattacctgaagaccgcccgcttcaagctcggctgcgccacgatctcggccgccgcgtcgcgggctgttcaattgcgcatcatcaatccctaataa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z