BBa_G00101 1 VR Reverse primer for sequencing/amplifying BioBrick parts (VR) 2004-05-24T11:00:00Z 2015-08-31T04:07:28Z Originally named VR, This reverse primer binds downstream of the standard BBa_MSC on biobrick vectors. Used for general-purpose PCR and sequencing of Biobrick parts. false true _11_1_ 0 60 7 Not in stock false false Tom Knight annotation1934519 1 VR range1934519 1 1 20 BBa_G00101_sequence 1 attaccgcctttgagtgagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z