BBa_G00106 1 M13-F(-46) M13-F (-46) 2006-06-07T11:00:00Z 2015-08-31T04:07:28Z Ancient M13 forward sequencing primer (46 bp upstream) false false _1_ 0 6 48 Not in stock false Ancient false Tom Knight BBa_G00106_sequence 1 gccagggttttcccagtcacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z