BBa_G00109 1 SP6 SP6 promoter sequencing primer, 24-mer 2008-10-16T11:00:00Z 2015-08-31T04:07:28Z SP6 RNA Polymerase promoter This primer is complementary to a portion of the SP6 RNA Polymerase promoter and can be used to sequence DNA inserted in the polylinker regions of common cloning vectors. false false _41_ 0 126 162 Not in stock false <biblio> #Melton pmid=6091052 #Chen Chen, E. et al. (1984) DNA, 4, 165-170. </biblio> false Reshma Shetty BBa_G00109_sequence 1 catacgatttaggtgacactatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z