BBa_G00111 1 T3 T3 promoter primer, 20-mer 2008-10-16T11:00:00Z 2015-08-31T04:07:28Z T3 promoter This primer is complementary to the consensus sequence in all Class III (1) promoters for T3 RNA Polymerase. false false _41_ 0 126 162 Not in stock false <biblio> #McGraw pmid=3903658 </biblio> false Reshma Shetty BBa_G00111_sequence 1 attaaccctcactaaaggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z