BBa_G00113 1 T7 T7 promoter sequencing primer, 20-mer 2008-10-16T11:00:00Z 2015-08-31T04:07:28Z T7 promoter. This primer anneals to the T7 Promoter region of any vector containing the T7 Promoter. false true _41_ 0 126 162 It's complicated false <biblio> #Wallace pmid=6282692 </biblio> false Reshma Shetty BBa_G00113_sequence 1 taatacgactcactataggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z