BBa_G00200 1 CFP/YFP-f Forward primer for sequencing composite parts; binds to CFP/YFP (BBa_E0020/22, BBa_E0030/32) 2004-06-01T11:00:00Z 2015-08-31T04:07:28Z -- No description -- false false _11_1_ 0 60 7 Not in stock false false cconboy BBa_G00200_sequence 1 ccacaagttcagcgtgtccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z