BBa_G1003 1 Prefix-R Reverse primer for amplifying BioBrick plasmid backbones by PCR (Prefix-r) 2008-10-16T11:00:00Z 2015-08-31T04:07:28Z The BioBrick prefix. The primer sequence that binds to the BioBrick prefix for PCR amplification of BioBrick plasmid backbones. This sequence is used by Meagan Lizarazo at the Registry. false false _41_ 0 126 162 Not in stock false This primer sequence is 1 nucleotide shorter than [[Part:BBa_G1001|BBa_G1001]]. false Reshma Shetty BBa_G1003_sequence 1 tctagatgcggccgcgaattc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z