BBa_G1005 1 BioBrick-r Reverse BioBrick suffix primer for amplifying BioBrick parts (BioBrick-r) 2008-10-16T11:00:00Z 2015-08-31T04:07:28Z The BioBrick suffix. Reverse primer that binds to the BioBrick suffix. It is useful for amplifying BioBrick parts. false false _41_ 0 126 162 Not in stock false It includes extra bases on the 5' end to enable both efficient cutting by EcoRI and 3' A addition by Taq polymerase. false Reshma Shetty BBa_G1005_sequence 1 gtttcttcctgcagcggccgctactagta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z