BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_I0416 1 BBa_I0416 RBS Test R0011.B0033.E0030.B0015 2004-06-13T11:00:00Z 2015-08-31T04:07:28Z R0011.B0033.E0030.B0015 RBS Test false true _11_1_ 0 61 7 Not in stock false false jcbraff component2221280 1 BBa_R0011 component2221286 1 BBa_B0033 component2221288 1 BBa_E0030 component2221295 1 BBa_B0015 annotation2221288 1 BBa_E0030 range2221288 1 81 803 annotation2221280 1 BBa_R0011 range2221280 1 1 54 annotation2221295 1 BBa_B0015 range2221295 1 812 940 annotation2221286 1 BBa_B0033 range2221286 1 64 74 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 annotation1999 1 lac O1 range1999 1 3 19 annotation2001 1 lac O1 range2001 1 26 42 BBa_E0030 1 eyfp enhanced yellow fluorescent protein derived from A. victoria GFP 2004-03-02T12:00:00Z 2015-08-31T04:07:25Z Modificaitons to Clontech EYFP by Reshma Shetty Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation1714 1 RBS range1714 1 7 10 annotation7028 1 BBa_B0033 range7028 1 1 11 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0033_sequence 1 tcacacaggac BBa_I0416_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtcacacaggactactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0030_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z