BBa_I10017 1 BBa_I10017 2006-04-05T11:00:00Z 2015-08-31T04:07:29Z false false _89_ 0 619 89 Not in stock false false Lissa Riley component1834723 1 BBa_B0021 component1834718 1 BBa_B0034 component1834720 1 BBa_J08001 annotation1834723 1 BBa_B0021 range1834723 1 354 399 annotation1834720 1 BBa_J08001 range1834720 1 19 345 annotation1834718 1 BBa_B0034 range1834718 1 1 12 BBa_J08001 1 BBa_J08001 -- Death -- 2005-09-01T11:00:00Z 2015-08-31T04:08:20Z The cytotoxic ccdb gene true false _39_ 0 286 39 Discontinued false false Graham Wiley BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0021 1 BBa_B0021 LuxICDABEG (+/-), reversed 2003-10-13T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Bidirectional transcriptional terminator cloned in the reverse direction of B0011. 22 bp stem-loop false true _1_ 0 24 7 In stock false Cloned with primer-dimers into pSB1A2 true Caitlin Conboy annotation7024 1 BBa_B0021 range7024 1 1 46 BBa_J08001_sequence 1 atgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgttcagagtgacattattgacacgcccgggcgacggatggtgatccccctggccagtgcccgcctgctgtcagacaaagtctcccgtgagctttacccggtggtgcatgtcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagtcaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_B0034_sequence 1 aaagaggagaaa BBa_B0021_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctct BBa_I10017_sequence 1 aaagaggagaaatactagatgagaacagggactggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgttcagagtgacattattgacacgcccgggcgacggatggtgatccccctggccagtgcccgcctgctgtcagacaaagtctcccgtgagctttacccggtggtgcatgtcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagtcaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataatactagagaaataataaaaaagccggattaataatctggctttttatattctct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z