BBa_I10088 1 Cyanide Ki Cyanobacterial Nitrogenase Coding Region 2006-04-25T11:00:00Z 2015-08-31T04:07:29Z This gene isolated from species of the genus Anabaena encodes the protein nitrogenase, which degrades cyanide and generates methane and ammonia. This part would theoretically be a preliminary part, which could be subjected to experiments in which it would be cut at various sites. The goal of these experiments would be to isolate the part of the gene which would halt the cyanide-> methane + ammonia reaction at the phase of the reaction's intermediates, namely imines and hydrogen-based compounds. This piece of the coding region could then be used to create a cyanide-degrading part which does not release the hazardous methane and ammonia products. false false _89_ 0 642 89 Not in stock false false Stephen Payne annotation1848588 1 stop range1848588 1 244 246 annotation1848587 1 start range1848587 1 1 3 BBa_I10088_sequence 1 atgtttactccatttactgtaaatggcagttctttgcaattgctaaaagttggcgatcgcggaatagtcaagttctgcaatattcaagataaaaatattctcaaaaaactcaagtctctgggcttaaataccggagtcactatcaccatagagcaagcttctttaattattcaagtaggaagcattctcttagaaatagataaagaacttgctcgtaacatctacgttcgtgtaattaataattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z