BBa_I1021 1 BBa_I1021 Antisense RNA w/BBa_I1020 Interference (KISS) 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z Anti-sense secondary structure adapted from: Mizuno, T., <em>Proc. Natl. Acad. Sci. USA</em> (1984) 81, 1966-1970<br> Sequence for antisense RNA that interferes with BBa_I1020 mRNA using the KISS scheme. false false _1_ 0 24 7 It's complicated false <P> <P> <bb_part>BBa_I1021</bb_part> antisense RNA is designed to interfere with <bb_part>BBa_I1020</bb_part> mRNA with no expected secondary structure interactions (dubbed the KISS scheme for Keep is Simple Samantha). The sequence is designed to interfere exclusively with <bb_part>BBa_I1020</bb_part>, and act independently of <bb_part>BBa_I1010</bb_part> and <bb_part>BBa_I1011</bb_part>. These parts are designed to use codon space to code for the same protein (<bb_part>BBa_I1010</bb_part> and <bb_part>BBa_1020</bb_part> code for lambda cI) while allowing for independent anti-sense regulation of the <bb_part>BBa_I1010</bb_part> and <bb_part>BBa_1020</bb_part> transcripts via <bb_part>BBa_I1011</bb_part> and <bb_part>BBa_1021</bb_part><P> false June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1837 1 start range1837 1 71 73 annotation7047 1 BBa_I1021 range7047 1 1 104 annotation1836 1 suffix range1836 1 101 104 annotation1839 1 cI CDS Reverse Complement range1839 1 1 73 annotation1838 1 cI mRNA reverse complement range1838 1 1 100 annotation1840 1 reverse complement range1840 1 78 83 BBa_I1021_sequence 1 tctcgtagatggccttgagacggcgggcatcttcgagttgttcctgagtcaaaggctttttcttagtactcatcttgttgtctgattattgatttttcgctact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z