BBa_I1022 1 BBa_I1022 Antisense RNA w/BBa_I1020 Interference (micRNA) 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z Anti-sense secondary structure adapted from: Mizuno, T., et al. <em>Proc. Natl. Acad. Sci. USA</em> (1984) 81, 1966-1970 Sequence for antisense RNA that interferes with BBa_I1020 mRNA using the micRNA scheme. false false _1_ 0 24 7 It's complicated false References (unparsed) here: <p>Mizuno, T., et al. <em>Proc. Natl. Acad. Sci. USA</em> (1984) 81, 1966-1970 </P> <P>Coleman, J., et al. <em>Cell</em> (1984) 37, 429-36</P> <P> References (unparsed) here: <p>Mizuno, T., et al. <em>Proc. Natl. Acad. Sci. USA</em> (1984) 81, 1966-1970 </P> <P>Coleman, J., et al. <em>Cell</em> (1984) 37, 429-36</P> <P> <bb_part>BBa_I1022</bb_part> antisense RNA is designed to interfere with <bb_part>BBa_I1020</bb_part> mRNA via the micRNA scheme (Mizuno, T., et al. <em></em><em>Proc. Natl. Acad. Sci. USA</em> (1984) 81, 1966-1970). The sequence is designed to interfere exclusively with <bb_part>BBa_I1020</bb_part>, and act independently of <bb_part>BBa_I1010</bb_part> and <bb_part>BBa_I1012</bb_part>. These parts are designed to use codon space to code for the same protein (<bb_part>BBa_I1010</bb_part> and <bb_part>BBa_1020</bb_part> code for lambda cI) while allowing for independent anti-sense regulation of the <bb_part>BBa_I1010</bb_part> and <bb_part>BBa_1020</bb_part> transcripts via <bb_part>BBa_I1012</bb_part> and <bb_part>BBa_1022</bb_part>. <P> false June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1842 1 stem_loop range1842 1 1 57 annotation1848 1 RBS Reverse Complement range1848 1 135 140 annotation1847 1 cI CDS Reverse Complement range1847 1 58 130 annotation1846 1 cI mRNA reverse complement range1846 1 58 157 annotation7048 1 BBa_I1022 range7048 1 1 196 annotation1843 1 suffix range1843 1 193 196 annotation1845 1 start range1845 1 128 130 annotation1844 1 stem_loop range1844 1 158 192 BBa_I1022_sequence 1 taaaatcaataacttattcttaagtatttgacagcactgaatgtcaaaacaaaaccttctcgtagatggccttgagacggcgggcatcttcgagttgttcctgagtcaaaggctttttcttagtactcatcttgttgtctgattattgatttttcgctatttcaaccggatgcctggcattcggtttttttttact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z