##gff-version 3 ##sequence-region BBa_I1023 1 169 BBa_I1023 . non_covalent_binding_site 1 19 . + 0 ID=annotation1860;Name=TetR 1 BBa_I1023 . stem_loop 78 98 . + 0 ID=annotation1850;Name=stem_loop BBa_I1023 . stem_loop 60 116 . + 0 ID=annotation1855;Name=stem_loop BBa_I1023 . sequence_alteration 87 87 . + 0 ID=annotation1856;Name=HH117a mutation specific to I1020 and I1023 BBa_I1023 . sequence_alteration 57 59 . + 0 ID=annotation1857;Name=Extra Met for stem homology BBa_I1023 . promoter 20 25 . + 0 ID=annotation1861;Name=-35 BBa_I1023 . sequence_feature 55 56 . + 0 ID=annotation1858;Name=First 2 bp of cI I1020 BBa_I1023 . sequence_feature 67 72 . + 0 ID=annotation1852;Name=RBS Reverse Complement BBa_I1023 . engineered_region 1 169 . + 0 ID=annotation7049;Name=BBa_I1023 BBa_I1023 . start_codon 60 62 . + 0 ID=annotation1854;Name=start BBa_I1023 . non_covalent_binding_site 26 44 . + 0 ID=annotation1862;Name=TetR 2 BBa_I1023 . promoter 1 54 . + 0 ID=annotation1864;Name=TetR BBa_I1023 . promoter 43 48 . + 0 ID=annotation1863;Name=-10 BBa_I1023 . start_codon 55 55 . + 0 ID=annotation1859;Name=start >BBa_I1023 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacctgcacatcttgttgtctgattatt gatttttggcgaaaccatttgatcatatgacaagatgtgtatccaccttaacttaatgatttttaccaaaatcattagg ggattcatcag