##gff-version 3
##sequence-region BBa_I1023 1 169
BBa_I1023	.	promoter	43	48	.	+	0	ID=annotation1863;Name=-10
BBa_I1023	.	stem_loop	78	98	.	+	0	ID=annotation1850;Name=stem_loop
BBa_I1023	.	sequence_feature	67	72	.	+	0	ID=annotation1852;Name=RBS Reverse Complement
BBa_I1023	.	non_covalent_binding_site	1	19	.	+	0	ID=annotation1860;Name=TetR 1
BBa_I1023	.	stem_loop	60	116	.	+	0	ID=annotation1855;Name=stem_loop
BBa_I1023	.	sequence_alteration	87	87	.	+	0	ID=annotation1856;Name=HH117a mutation specific to I1020 and I1023
BBa_I1023	.	engineered_region	1	169	.	+	0	ID=annotation7049;Name=BBa_I1023
BBa_I1023	.	non_covalent_binding_site	26	44	.	+	0	ID=annotation1862;Name=TetR 2
BBa_I1023	.	promoter	1	54	.	+	0	ID=annotation1864;Name=TetR
BBa_I1023	.	start_codon	60	62	.	+	0	ID=annotation1854;Name=start
BBa_I1023	.	sequence_feature	55	56	.	+	0	ID=annotation1858;Name=First 2 bp of cI I1020
BBa_I1023	.	sequence_alteration	57	59	.	+	0	ID=annotation1857;Name=Extra Met for stem homology
BBa_I1023	.	promoter	20	25	.	+	0	ID=annotation1861;Name=-35
BBa_I1023	.	start_codon	55	55	.	+	0	ID=annotation1859;Name=start
>BBa_I1023
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacctgcacatcttgttgtctgattatt
gatttttggcgaaaccatttgatcatatgacaagatgtgtatccaccttaacttaatgatttttaccaaaatcattagg
ggattcatcag