BBa_I1030 1 BBa_I1030 RNA Regulation Target ( Promoter driven by C0040 and cI mod #1 CDS) 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z see references Coding region for the tetR promoter (<bb_part>BBa_C0040</bb_part>) with antisense binding region for <bb_part>BBa_I1031</bb_part> and <bb_part>BBa_I1032</bb_part>, and a codon modified cI(1) protein with an LVA degradation tail. false false _1_ 0 24 7 It's complicated false <P> <P> <bb_part>BBa_I1030</bb_part> Custom cI Protein with TetR Promoter is based on BioBricks <bb_part>BBa_C0050</bb_part> and <bb_part>BBa_R0040</bb_part>. It is designed such that <bb_part>BBa_I1031</bb_part> and <bb_part>BBa_I1032</bb_part>can be used to interfere with the <bb_part>BBa_1030</bb_part> transcript by anti-sense mRNA binding, in the KISS or micRNA method shown below. <bb_part>BBa_I1030</bb_part> and <bb_part>BBa_I1031</bb_part> or <bb_part>BBa_I1032</bb_part> can act indepently of related biobrick parts <bb_part>BBa_I1041</bb_part>, <bb_part>BBa_I1042</bb_part>, <bb_part>BBa_I1020</bb_part>, <bb_part>BBa_BBa_I1023</bb_part> and <bb_part>BBa_1013</bb_part>. [<A href="http://biobricks.ai.mit.edu/BB_References.htm#KEIL96">KEIL96</A>] <P> Incompatible with systems containing IPTG, or cI. <p> May be some cross talk with systems containing <bb_part>BBa_I1010</bb_part>. Compatible with all other BBa_line I-line parts. <p> Proper operation requires AMP/CAP complex, which should normally be present in the cell. false Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation1868 1 modified cI1 cds range1868 1 94 163 annotation1873 1 TetR range1873 1 1 54 annotation1874 1 SsrA range1874 1 802 840 annotation1869 1 TetR 1 range1869 1 1 19 annotation1871 1 TetR 2 range1871 1 26 44 annotation1880 1 intentional junk dna range1880 1 85 88 annotation1870 1 -35 range1870 1 20 25 annotation1877 1 intentional junk dna range1877 1 55 74 annotation1875 1 2 range1875 1 835 840 annotation1879 1 rbs range1879 1 77 82 annotation1866 1 cI range1866 1 91 840 annotation1867 1 start range1867 1 91 93 annotation7050 1 BBa_I1030 range7050 1 1 840 annotation1881 1 antisense RNA pairing range1881 1 55 162 annotation1878 1 start range1878 1 55 55 annotation1872 1 -10 range1872 1 43 48 BBa_I1030_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacagctttgcacaacagcaacgacaggaaaccggttcgatgtcgacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z