BBa_C0020 1 cheY CheY "tumbling" chemotaxis coding sequence 2004-08-01T11:00:00Z 2015-08-31T04:07:23Z NCBI - Escherichia coli K12 MG1655 (NC_000913) This part codes for CheY, a protein used by E. coli for chemotaxis. Increased concentrations of CheY has been shown to make E. coli tumble more. false true _6_ 0 101 7 It's complicated false Changes from the NCBI sequence: A BioBricks restriction site for PstI was at position 260. As a result, the codon starting at position 262 was changed from "gca" to "gcg". <p> The terminating codon at the end, "tga", was changed to "taataa" as per BioBrick regulations as told to us by Randy Rettberg. false Victoria Chou, Kenneth Nesmith, Madeleine Sheldon-Dante annotation1891581 1 cheY range1891581 1 1 393 BBa_I10320 1 BBa_I10320 2006-04-06T11:00:00Z 2015-08-31T04:07:29Z false false _89_ 0 635 89 Not in stock false false Anthony Perez component2218207 1 BBa_C0020 component2218204 1 BBa_B0030 annotation2218204 1 BBa_B0030 range2218204 1 1 15 annotation2218207 1 BBa_C0020 range2218207 1 22 414 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_B0030_sequence 1 attaaagaggagaaa BBa_C0020_sequence 1 atggcggataaagaacttaaatttttggttgtggatgacttttccaccatgcgacgcatagtgcgtaacctgctgaaagagctgggattcaataatgttgaggaagcggaagatggcgtcgacgctctcaataagttgcaggcaggcggttatggatttgttatctccgactggaacatgcccaatatggatggcctggaattgctgaaaacaattcgtgcggatggcgcgatgtcggcattgccagtgttaatggtgactgcggaagcgaagaaagagaacatcattgctgcggcgcaagcgggggccagtggctatgtggtgaagccatttaccgccgcgacgctggaggaaaaactcaacaaaatctttgagaaactgggcatgtaataa BBa_I10320_sequence 1 attaaagaggagaaatactagatggcggataaagaacttaaatttttggttgtggatgacttttccaccatgcgacgcatagtgcgtaacctgctgaaagagctgggattcaataatgttgaggaagcggaagatggcgtcgacgctctcaataagttgcaggcaggcggttatggatttgttatctccgactggaacatgcccaatatggatggcctggaattgctgaaaacaattcgtgcggatggcgcgatgtcggcattgccagtgttaatggtgactgcggaagcgaagaaagagaacatcattgctgcggcgcaagcgggggccagtggctatgtggtgaagccatttaccgccgcgacgctggaggaaaaactcaacaaaatctttgagaaactgggcatgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z