BBa_I1040 1 BBa_I1040 RNA Regulation Target ( Promoter driven by C0010 and cI(2) CDS) 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z see references Coding region for the LacO-1 promoter with antisense binding region for <bb_part>BBa_I1041</bb_part> and <bb_part>BBa_I1042</bb_part>, and a codon modified cI(1) protein with an LVA degradation tailCoding region for the LacI protein with an LVA degradation tail and without an RBS. LacI binds to the pLac regulator (<bb_part>BBa_R0010</bb_part>) and hybrid Pl-lac01 regulator as is used in parts <bb_part>BBa_I1020</bb_part>, <bb_part>BBa_I1023</bb_part>, <bb_part>BBa_I1031</bb_part>, <bb_part>BBa_I1032</bb_part>, <bb_part>BBa_I1040</bb_part>, <bb_part>BBa_I1041</bb_part>, <bb_part>BBa_I1042</bb_part>, <bb_part>BBa_I1060</bb_part>, <bb_part>BBa_I1063</bb_part>, <bb_part>BBa_I1020</bb_part>. IPTG (Isopropylthiogalactoside) binds to LacI and inhibits its operation, thus allowing transcription. This is the basis of an "Implies" gate.</P> false false _1_ 0 24 7 It's complicated false <P> <P> <bb_part>BBa_I1040</bb_part> Custom cI Protein with LacO-1 Promoter is based on BioBricks <bb_part>BBa_C0050</bb_part>. It is designed such that <bb_part>BBa_I1041</bb_part> and <bb_part>BBa_I1042</bb_part> can be used to interfere with the <bb_part>BBa_1040</bb_part> transcript by anti-sense mRNA binding, in the KISS or micRNA method shown below. <bb_part>BBa_I1040</bb_part> and <bb_part>BBa_I1041</bb_part> or <bb_part>BBa_I1042</bb_part> can act indepently of related biobrick parts <bb_part>BBa_I1031</bb_part>, <bb_part>BBa_I1032</bb_part>, <bb_part>BBa_I1020</bb_part>, and <bb_part>BBa_1013</bb_part>. [<A href="http://biobricks.ai.mit.edu/BB_References.htm#KEIL96">KEIL96</A>]<P> Incompatible with systems containing IPTG, lactose, lacI, or cI. <p> May be some cross talk with systems containing <bb_part>BBa_I1020</bb_part> or <bb_part>BBa_I1060</bb_part>. Compatible with all other BBa_line I-line parts. <p> Proper operation requires AMP/CAP complex, which should normally be present in the cell. false Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation7055 1 BBa_I1040 range7055 1 1 841 annotation1912 1 SsrA range1912 1 803 841 annotation1910 1 -35 range1910 1 21 26 annotation1919 1 intentional junk dna range1919 1 86 89 annotation1908 1 start range1908 1 92 94 annotation1920 1 antisense RNA pairing range1920 1 56 163 annotation1917 1 intentional junk dna range1917 1 56 75 annotation1914 1 LacO-1 region range1914 1 1 20 annotation1911 1 -10 range1911 1 44 49 annotation1915 1 LacO-1 range1915 1 27 43 annotation1909 1 cI lambda range1909 1 92 841 annotation1913 1 2 range1913 1 836 841 annotation1918 1 RBS range1918 1 78 83 annotation1916 1 start range1916 1 56 56 BBa_I1040_sequence 1 ataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcacctggagcacactactgtcgcacaggaaaccctagcgatgagtactaagaaaaagcctttgactcaggaacaactcgaagatgcccgccgtctcaaggccatctacgagaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z