BBa_I1063 1 BBa_I1063 CI(2) IS10 asRNA 2003-01-31T12:00:00Z 2015-08-31T04:07:30Z see referencers Region which serves as basis for transcription of asRNA that binds to and inhibits <bb_part>BBa_I1060</bb_part> mRNA transcript. Part of the XOR gate comprised of <bb_part>BBa_I1010</bb_part> and <bb_part>BBa_I1060</bb_part>, their corresponding asRNA coding sequences (<bb_part>BBa_I1013</bb_part> and <bb_part>BBa_I1063</bb_part>). false false _1_ 0 24 7 It's complicated false <P> <P> Complementary to beginning of <bb_part>BBa_I1060</bb_part> transcript covering 5' region, RBS, start codon, and 5 bp into coding sequence. Secondary structure designed for the IS10 anti-sense mRNA mechanism (See below). <P> Can be used with all parts of the BBa_I system. It inhibits <bb_part>BBa_I1060</bb_part>. Incompatible with systems containing cI (wild type) false Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation1977 1 swap range1977 1 112 112 annotation1968 1 C added range1968 1 57 59 annotation1972 1 swap range1972 1 66 66 annotation1978 1 swap range1978 1 113 113 annotation1973 1 swap range1973 1 73 73 annotation1969 1 Binds first 2 bf of I1060, I1020 range1969 1 55 56 annotation1966 1 start range1966 1 60 62 annotation1964 1 RBS Reverse Complement range1964 1 67 72 annotation1980 1 TetR 1 range1980 1 1 19 annotation1962 1 stem_loop range1962 1 78 98 annotation1970 1 swap range1970 1 63 63 annotation1984 1 TetR range1984 1 1 54 annotation7061 1 BBa_I1063 range7061 1 1 169 annotation1974 1 HH117a swap range1974 1 87 87 annotation1967 1 stem_loop range1967 1 60 116 annotation1975 1 swap range1975 1 103 103 annotation1979 1 start range1979 1 55 55 annotation1982 1 TetR 2 range1982 1 26 44 annotation1971 1 swap range1971 1 64 64 annotation1976 1 swap range1976 1 110 110 annotation1981 1 -35 range1981 1 20 25 annotation1983 1 -10 range1983 1 43 48 BBa_I1063_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacctgcacatgatcttgtctcattattgatttttggcgaaaccatttgatgatatgagatcatgtgtatccaccttaacttaatgatttttaccaaaatcattaggggattcatcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z