BBa_I12005 1 Prm rna lambda Prm Inverted Antisense (No start codon) 2004-07-13T11:00:00Z 2015-08-31T04:07:31Z "Mutations affecting two different steps in transcription initiation at the phage lamda Prm Promoter", Shih & Gussin, January 1983 lambda Prm (BBa_I12003) with the nucleotide sequence reversed to fit in with BioBricks (start codon not included) false true _3_ 0 148 7 Not in stock false false ryhsiao annotation784291 1 Pr range784291 1 1 3 annotation784467 1 OR1 range784467 1 12 28 annotation784498 1 OR2 range784498 1 36 52 annotation784302 1 Prm range784302 1 86 88 annotation784558 1 OR3 range784558 1 59 75 BBa_I12005_sequence 1 catgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgatagatttaacgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z