BBa_I12034 1 Prm+ Modified lamdba Prm promoter (repressed by 434 cI with cooperativity) RBS+ 2004-08-05T11:00:00Z 2015-08-31T04:07:31Z Bushman, F. D. The bacteriophage 434 right operator roles of O-R1, O-R2, and O-R3. J. Mol. Biol. (1993) 230, 28-40. Lamdba Prm promoter modified to be activated by lamda repressor (cI) and repressed by 434 repressor (cI) with both activation and repression taking advantage of cooperativity. false false _3_ 0 148 7 Not in stock false The O-R1 region of 434 contained 14 base pairs as opposed to the 17 base pairs of the O-R3 site of lambda. Also, it was noticed that the O-R3 site of the lambda included part of the -10 site. Hence, to preserve the spacing and the -10 site, the three nucleotides that were in both the -10 site and the lambda O-R3 site were retained. The 14 nucleotides that were in the O-R3 site and not in the -10 site were replaced with the O-R1 site of the 434. To allow 434 cI to take advantage of cooperativity and to maintain spacing, the -10 site was left undisturbed, but immediately following, the space was replaced with the OR-2 site of 434 cI. Thus, if 434 cI is present in the system, it will bind to both the OR-1 and OR-2 sites of 434, preventing transcription. However, if there is no 434 cI present, then a portion of the OR-2 site will be included in the mRNA, which should not result in any problems. false ryhsiao annotation1030781 1 -10 range1030781 1 71 76 annotation1030775 1 OR2 lambda range1030775 1 33 49 annotation1030779 1 OR1 434 range1030779 1 56 69 annotation1030773 1 OR1 lambda range1030773 1 9 25 annotation1030774 1 -35 range1030774 1 48 53 annotation1030796 1 conserved range1030796 1 96 101 annotation1030783 1 BBa_B0034 (Elowitz) range1030783 1 92 103 annotation1030782 1 OR2 434 range1030782 1 77 91 BBa_I12034_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatattacaaactttcttgtatagattacaatgtatcttgtaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z