BBa_I12035 1 Prm + Modified lamdba Prm promoter (repressed by p22 cI without cooperativity) RBS+ 2004-08-05T11:00:00Z 2015-08-31T04:07:31Z Bushman, F. D. The bacteriophage 434 right operator roles of O-R1, O-R2, and O-R3. J. Mol. Biol. (1993) 230, 28-40. Lamdba Prm promoter modified to be activated by lamda repressor (cI) and repressed by p22 repressor (cI). false false _3_ 0 148 7 Not in stock false The O-R3 region of the lambda cI strand was mutated by 7 nt to eliminate any binding in the region. This was not replaced with the O-R1 region of p22 due to the fact that the O-R1 site had a length of 18 nt, while the space between the -10 and -35 regions was only 16 nt. Thus, spacing would not be preserved, and this could cause many problems. However, since p22 cI must still repress the production of the lambda cI protein, the OR-1 site of p22 was still placed within the construct. The positioning is right after the -10 region (between the -10 region and the RBS). Thus, when p22 cI binds in, protein production should still be inhibited, whereas, if p22 does not bind in, there will just be a little extra code in the mRNA, which theoretically should not cause any problems. false ryhsiao annotation1031124 1 -35 range1031124 1 47 53 annotation1031132 1 -10 range1031132 1 70 76 annotation1031120 1 OR2 lambda range1031120 1 33 49 annotation1031142 1 OR1 (p22) range1031142 1 77 94 annotation1031143 1 BBa_B0034 (Elowitz) range1031143 1 95 106 annotation1031128 1 Obliterate OR3 range1031128 1 59 65 annotation1031153 1 conserved range1031153 1 99 104 annotation1031116 1 OR1 lambda range1031116 1 9 25 BBa_I12035_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagattattaaagaacacttaaataaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z